English French German Italian Portuguese Russian Spanish

La Evolucion del Caballo de Paso Fino - Parte 1

20150614 IMG 0254

El caballo de paso fino es una raza que se ha estado formando hace muchos anos por criadores estudiosos y con criterio donde se ha definido que su movimiento de traslación es por laterales es decir pata y mano del mismo lado en cuatro tiempos iguales y

marcan un ritmo cuyo sonido es claro al escucharlo cuando están en movimiento y es , ta-ca -ta-ca ta-ca- ta-ca y su desplazamiento es natural por lo cual son sumamente cómodos cuando se montan y de una gran brillantes cuando están bien adiestrados.

Estos caballos cuando se monta una persona poco experta siempre están en Paso Fino, cuando se monta un experto lucen aún mas y demuestran su brío y armonía pero siempre conservando sus andares y marcando El TA-CA-TA-CA. que se escucha claro por el montador y los que lo están observando.

Me preocupa lo que esta ocurriendo actualmente con los caballos de Paso Fino “moderno” que ejecutan diagonales y laterales. Si los monta una persona que no conozca los trucos o ajustes que hacen sus montadores para presentarlos como finos, estos caballos demostraran su paso natural que es trocha. Movimiento en diagonal a cuatro tiempos.

Los caballos y yeguas que tienen la facilidad de hacer diagonales y laterales al reunirlos y exigirles mas energía dan un verdadero espectáculo para el publico que es un deleite para la vista.

Creo firmemente que los directivos de las Asociaciones deben tomar cartas en este asunto porque este cambio tan brusco que han sido los mismos jueces que lo han permitido ha perjudicado y va a perjudicar mucho a los criadores, aficionados y al mismo caballo de paso fino tradicional.

El caballista americano tanto como el europeo y el latino americano entienden que el caballo de silla de paso fino es decir el caballo de paso fino natural o tradicional no es el mas veloz del mundo, ni que salta tan alto como otras razas, pero lo que les llama la atención es que su calidad consiste en que es capaz de hacer todo y de forma muy cómoda y siendo además muy resistente. Los caballos de paso fino natural llevan a su jinete cómodamente cuando los cabalgan y son muy apreciados en las competencias; por lo cual no podemos permitir que los caballos de show o “modernos” que estamos viendo últimamente desplacen a la raza tradicional que es la que se puede promover para otros países.

¿Que haría un americano o un europeo montando un caballo de los de show de ahora?

No me opongo al cambio y a la evolución del caballo pero si descuidamos la raza tradicional del caballo de paso fino natural vamos a perder el esfuerzo y progreso que nuestros antepasados con trabajo y sacrificio lograron para el reconocimiento que el caballo de paso fino tradicional posee hoy como el caballo más suave del mundo para montar y que no importa la edad, su suavidad y naturalidad al desplazarse satisface y deslumbra a cualquier persona que lo monta.

En cuanto al mercadeo del caballo, si nuestros directivos siguen permitiendo que los caballos de paso fino natural compitan con los caballos de aire compuesto estos siempre ganaran y los interesados en adquirir un caballo de paso fino se inclinaran por el caballo de show ya que estos por su reunión, energía y cadencia rápida sobresalen a los finos naturales que son de cadencia intermedia y un poco más desplazados en su movimiento.

Así mismo, el valor de estos caballos de Show es muy alto y como se dicen que son de paso fino, esto hace pensar al futuro comprador que los caballos de paso fino en general son muy costosos por lo cual la persona no se anima a comprar un caballo de paso fino mientras no se le explique que uno es un caballo de Show espectacular para la vista y el otro es un caballo más funcional para disfrutarlo. Por lo tanto hay que separar estos dos estilos de andares de caballos y esto permitirá más negocios y la expansión del caballo de paso fino tradicional.

Vemos también una monopolización porque quienes se benefician de este nuevo caballo de paso fino “moderno” son únicamente los dueños de reproductores que trasmiten esta nueva modalidad que por cierto se cuentan en los dedos de la mano.

Los criadores que han invertido toda su vida en los caballos de paso fino puro o tradicional se encuentran que son pocos los compradores que quieren estos caballos porque en las competencias rara vez son tenidos en cuenta por los jueces.

Los entrenadores si no tienen caballos y yeguas que trochen sino que solamente sean muy finas novan a figurar en las competencias.
Se está acabando el interés por los caballos puros de paso fino porque las nuevas generaciones están viendo otro estilo de caballos de paso fino.

Quien compre un caballo de este nuevo estilo tiene que tener entrenador especial para que lo presente y compita y entonces quien quiere tener un caballo de paso fino natural.

Quiero que quede claro no estoy en contra de estos caballo, los veo muy espectaculares y son caballos que hacen un show fuera de serie para disfrutar de las habilidades de los mismos y del trabajo de los entrenadores, por lo tanto sugiero a los directivos de Asociaciones, Federaciones que reflexionen y piensen en el problema.

La definición conocida de la raza de caballos de paso fino es los que se mueven por laterales todo el tiempo en cuatro tiempos y que marcan un ritmo isócrono en la pisada y que se escucha TA-CA-TA-CA- TA-CA…………………….sea de cabestro , a la cuerda y montados.
A estas características deberíamos entonces poder agregarle que conocemos que el caballo de paso fino puede ir por laterales y por diagonales, es decir ta-ca-ta-ca. tras tras y tas tas y no penalizar si trochan o trotan. De lo contrario hay que separar una caballo del otro e inventarse una categoría separada para los caballos de paso fino que ya no caben en el paso fino clásico o moderno de show. Una competencia exclusivamente para los que se trasladan por laterales y otra para los que tienen aire compuesto.

Los invito a que hagan este ejercicio escuche el sonido del ritmo de un caballo o yegua fina definida ta-ca ta-ca ta- ca ta-ca.y pronuncielo.
Haga el mismo ejercicio con un paso fino que hace diagonales. Empieza muy bien ta-ca—ta-ca y luego se va escuchando tacatacatacatacataca y si ud. se concentra escuchara un sonido distorsionado que no es claro, lo cual lo produce la acción del montador al habilitar el caballo que va por diagonales y se va a los laterales con una cadencia rápida y habilitada, no natural. En cambio el paso fino natural de habilitarse demasiado pasa al andoneo.

La cadencia es la velocidad del ritmo. Hay cadencia natural propia y cadencia habilitada.

El caballo paso fino natural tiene cadencia intermedia; el caballo de paso fino que hace diagonales sin ayudas trocha y si se ayuda hace una cadencia rápida.

El caballo de trocha debe tener una cadencia rápida.

El caballo de Trote debe tener una cadencia lenta.

S.O.S Alerto a los directivos de Federaciones, Asociaciones, Criadores, Propietarios Jueces y Entrenadores que se haga una campaña para salvar nuestro caballo tradicional de PASO FINO natural.

Posted in Blog

Que es el Paso Fino: Informacion basica

  1. Que es el Paso Fino? Es un raza de caballos.
    Caracteristicas: Es un caballo que se desplaza por laterales en cuatro tiempos iguales. En palabras muy sencillas, laterales quiere decir que mueve pata y mano del mismo lado. Si el movimiento comienza con la pata izquierda es seguido por la mano izquierda y luego movera mano y pata del lado contrario pero, cada pata asienta sus cascos en el piso en momentos o tiempos diferentes marcando los cuatro tiempos iguales.

Posted in Blog

Continue Reading

La Evolucion del Caballo de Paso Fino - Parte 2

Dice claramente la definición de la raza de caballos de paso fino que su característica principal es la forma de desplazarse que es por laterales, en cuatro tiempos iguales marcando un ritmo isócrono, cuyo sonido es ta-ca-ta-ca. ta-ca.ta-ca.

En Colombia, las Asociaciones y los criadores de Paso Fino, venían por ahí hasta los años 80 produciendo caballos seleccionados de paso fino, procurando que tuvieran al menos tres generaciones de la misma raza. Fue así como tuvimos una caballada de caballos finos muy importantes pero llego lo que nadie previno, y el daño que a largo plazo afectaría nuestros caballos puros de paso fino, el cruce de yeguas finas con caballos que tuvieran en su sangre raza de diagonales sea en el padre o la madre.

Posted in Blog

Continue Reading

Raza Pura vs. Mestizaje

20150613 IMG 9067

Una de las tantas inquietudes que nos planteamos los caballistas, en todos los círculos (mas o menos conocedores de nuestro caballo de paso) y en la que sigo muy interesado, es en descubrir las causas que afectan a nuestro caballo de paso fino clásico y por las cuales son pocos los caballos que al cumplir los 5 anos que es donde comienza su madurez y en la etapa donde poseen la capacidad que los puede llevar a alcanzar su máximo rendimiento, no progresan! 

Posted in Blog

Continue Reading

Llegada de los Caballos a America - Arrival of Horses to America

arrival of horses
Berber soldier riding an ambling Barb horse in the fifteenth century.(Original in the Alhambra,Granada, Spain.)

ARRIVAL OF HORSES TO AMERICA

On the first trip of Columbus (12 August 1492) he did not bring horses. On the second voyage (10 November of 1493), Christopher Columbus landed in the island of Borinquen (present Puerto Rico), in the Bay of Aguada. He gave the region the name of San Juan Baptist and brought the first horses to America. The horses originally selected by Christopher Columbus were exchanged prior to leaving Spain, but he was already on the high seas when he came to realize it.
On this second voyage of Columbus in 1493, he brought from Spain 25 specimens of which twenty (20) were stallions and five (5) were mares. These horses were undoubtedly of the Barb (Berber or Barbary) type which had a lateral gait. The natural process of reproduction, successive and future contributions to herds, the equine population enhanced and spread throughout the neighboring islands such as Cuba, Jamaica, and Dominican Republic. In the years afterward during the Conquest Period, conquerors derived their equine stock and supplies from these islands to expand Spain’s domain over North, Central and South America.
It is probably safe to say that Barb (Berber or Barbary) horses are the base of our present horses and that there is no other horse except the Barb which has had more influence on the development of equine breeds throughout the world. Today, only the Peruvian horse, Pure Puerto Rican horses and Colombian Pasos have survived with Barb-type qualities. However, many factors like enviromental, topographical, nutritional and consecutive breeding are of high importance in the process of evolution and development of the Paso Fino Horse.

LLEGADA DE LOS CABALLOS A AMERICA

En el primer viaje de Colón (12 Agosto 1492) no trajeron caballos. En el segundo (10 Noviembre de 1493), Cristóbal Colón desembarca en la isla de Borinquen (Puerto Rico actual), en la Bahía de Aguada. Le dió a la region el nombre de San Juan Bautista y trae los primeros caballos. Esta probado que los que seleccionó Colón le fueron cambiados y de ello vino a darse cuenta cuando ya estaba en alta mar.
En éste Segundo viaje de Colón, en 1493, llegaron desde España, 25 ejemplares de los cuales veinte eran caballos y cinco yeguas.
Estos caballos eran del tipo Berberisco y su movimiento de translación era por laterales de lo cual no hay ninguna duda. Con más aportes sucesivos y las crías naturales se fueron poblando de equinos las islas vecinas o sea Cuba, Jamaica, Republica Dominicana, etc… De allí se surtieron de caballos los conquistadores en los años posteriores para el dominio de todos los paises del norte, centro y sur América.
Es asi como podemos afirmar que el caballo berberisco fue la base de nuestros caballos actuales y que no hay otro caballo que haya tenido mayor influencia en el desarrollo de las diferentes razas equinas en el mundo como el caballo Berberisco. Hoy por hoy, sólo los caballos de paso peruano, el puro puertoriqueño y el paso fino colombiano conservan y comparten algunas caracteristicas del caballo Berberisco. Debe igualmente reconocerse la importancia que factores como el medio ambiente, los sucesivos cruces posteriores, la topografía y distinta alimentación han ejercido en el proceso de formacion de nuestro caballo de Paso Fino.

Posted in Blog

Caballos de Trote y Galope reunidos Colombianos

Quisiera ver Trotones Galoperos que ejecuten con una cadencia lenta en los dos aires, que muestren una suspensión que produce una sensación para el montador y el público.

Opino que esos caballos y yeguas de trote y galope reunidos me tienen muy confundido porque lo que muestran son unos ejemplares empujados e idos contra el freno y acercándose a una trocha.

Esto es producido por las ayudas del jinete que habilitan el caballo para llevarlo a una cadencia intermedia o rápida sacándolo de su cadencia natural propia que es lenta para el caballo de trote y galope.

Muchos jueces en la explicación dicen que tiene más velocidad un caballo sobre el otro. Quiero aclarar que la velocidad es los kilómetros por hora a los que se desplaza el caballo; la cadencia es la velocidad del ritmo y, la cadencia de cada aire debe ser siempre igual.

El caballo de trote y galope como aquí afirmo, posee una cadencia natural propia lenta con una pisada enérgica, elegancia, armonía y disposición.

Estamos viendo que el caballo de trote y galope que va marcando un trote con cadencia lenta ya no lo tienen en cuenta entonces los montadores para poder darle gusto a los jueces tienen que habilitar el ejemplar para alcanzar velocidad con resultados funestos como boca dura (contacto),extensión de tendones y confusión.

En lo que yo conozco de las diferentes razas de Trote y Galope como el Árabe, el Andaluz ,el Cuarto de Milla Americano, el Azteca y el Frisón entre otras razas de Trote y Galope que son pura, estos caballos mantienen esa cadencia lenta enérgica y armoniosa.

Entiendo que el arreglo de estos caballos es diferente al Trote y Galope reunido Colombiano; el caballo de trote tiene que tener cadencia lenta tanto en el trote como en galope. Este caballo requiere saberlo montar para mantener su cadencia lenta natural con energía en sus posteriores, brazos alegres y elevación media o alta.

Eso se consigue sin apretar las piernas, con un contacto bueno y dejando caer el peso del tronco superior sobre el asiento de la montura y una ayudas sutiles. Estoy seguro que si el caballo de trote y galope reunido Colombiano lo presentaran con una cadencia lenta estos serían los caballos más bellos y apetecidos ya que tienen ese arreglo de los chalanes colombianos que les dan armonía, reunión, energía y arreglo en su rienda y no habría confusión con los caballos de esa excelente raza de trocha que han igualmente perfeccionado los colombianos.

Yo como colombiano y caballista hasta la medula le sugiero a los directivos colombianos que hagan un estudio de la cadencia del caballo de trote y galope.                

Si esto es otro estilo que se inventaron los colombianos no he dicho nada pero sigo convencido que caballo de trote y galope es de cadencia lenta.       

Posted in Blog

Autoentrevista con Carlos Lemoine Andrade

¿Que opinión tiene de los caballos de Paso Fino?

Esta pregunta para mi tiene diferentes enfoques; el primero, el que considero más importante y el cual desarrollaré, se relaciona con la definición del andar presente en aquellos equinos, no importando el lugar geográfico donde nazcan, que al momento de trasladarse, lo hacen a través de un movimiento de avance por bípedos laterales, sucesivos y alternados, ejecutado en cuatro (4) tiempos, que guardan isocronismo entre cada una de sus batidas y que ofrece un sonido armónico y constante, cuya expresión sonora es: tacatacatacatacatacataca. Esta secuencia produce muy poca variación en sus lomos con relación a la horizontalidad del suelo, lo que los hace sumamente cómodos al montar.

El Paso Fino, como andar, se nos presenta de diferentes modos o con diferentes expresiones, pudiendo ver ejemplares que lo ejecutan con un tranco largo, otros de tranco medio y otros con un tranco corto, como también con una cadencia de ritmo alta, con cadencia media y/o baja y con mayor o menor energía al pisar, dentro de esos rangos, se ha ido desarrollando un proceso de selección que distingue a las diferentes modalidades dentro del andar del Paso Fino, podemos ver ejemplares que poseen diferentes combinaciones y de allí la versatilidad que presenta este particular andar.

La Evita 2

En USA, la PFHA, crea la competencia en las categoría del Classic Paso Fino; que son las que incluyen a los ejemplares que ejecutan este andar con un tranco más corto y con una cadencia de ritmo más rápida, la categoría de Performance Paso Fino; son donde vemos ejemplares con un tranco más extendido, con una cadencia de ritmo menos rápida, pero con gran energía en la pisada, lo que le da una gran brillantez en la presentación y la categoría Pleasure Paso Fino; son donde vemos ejemplares de un tranco extendido, pudiendo ser de cadencia media y sin mayor energía en la pisada. Este tipo de procedimiento en cuanto a modalidades en el andar del Paso Fino se practica, aunque con menos regularidad, en otros países del hemisferio norte, tales como; Canadá, Puerto Rico y República Dominicana.

En el resto de los países de América donde se lleva a cabo la actividad de la cría de la raza, se maneja una sola categoría en el Paso Fino y en esta caben todas las expresiones antes mencionadas, siempre y cuando cumplan con la definición del andar, de allí que veamos competir en Colombia, Venezuela, Ecuador, Panamá, Aruba y Curazao ejemplares que van desde los cortos y rápidos, hasta los de tranco largo y cadencia media.

Retomando la pregunta original, para mí dentro del caballo de paso, el Paso Fino es el andar primario y con mayor fortaleza genética, por ello ha dado pie a la formación de otros andares que también ofrecen gran comodidad al montarlos y por ende son considerados caballos de silla.

¿Como se formó esta raza?

En épocas distantes, donde la transportación se hacía necesariamente a caballo o en coches tirados por estos, ya existía una predilección por aquellos ejemplares que ofrecían mayor comodidad a la silla y cabalgar sobre ellos siempre fue un símbolo de distinción, por lo que menciono algunos sucesos relacionados y que hablan del tema:

  • En la China, en el siglo XIII durante el próspero reinado de la dinastía Song, era costumbre ver llegar a los auditores del emperador a los pueblos que serían fiscalizados, sobre suaves mulas de paso, esto le daba un aire de autoridad y elegancia, que los distinguía de los otros funcionarios imperiales.
  • En Francia, en la edad media, los caballeros montaban un caballo llamado “Palefrois” o Palefren (en español), muy cómodo y con paso amblado, era muy popular entre los nobles para la caza y las ceremonias, para combatir cambiaban sus cabalgaduras por un caballo de trote (Diagonal), llamado “Destries”, las damas preferían cabalgar en un corcel llamado “Hackney”, con que se denomina al caballo trotador de Norfolk.
  • En La India se criaron dos razas de caballos con andar lateral, una llamada Marwari y otra llamada Kathiawari, producto del cruce de Árabe, posiblemente Mongol y sangre de los caballos nativos de esa región, fueron usados desde el siglo XII y a lo largo de la historia, como un caballo de caballería por su cómodo andar y gran resistencia a las condiciones ambientales más extremas.
  • En la Edad Media, en Italia, los grandes personajes utilizaron a las mulas de paso como montura de lujo. En España para los tiempos de Moliere (1622- 1673) eran la montura preferida de médicos, magistrados y prelados, lo que originó que La Fontaine dijera: “La mula es un prelado que se las echa de noble.”
  • En Abisinia los Ras o gobernadores de provincias, así como las personas pudientes, montaban mulas de paso llamadas SANGAR.
  • Los Papas montaban en mulas de paso, por su comodidad, seguridad en la pisada y resistencia.

Esto demuestra que aquellos pasos amblados o derivados de la ambladura y que ofrecían una mayor comodidad, sin lugar a dudas fue el punto de partida de todos estos pasos modernos, incluyendo el Paso Fino.

Encontramos al paso de la historia sucesos importantes que tienen que ver con la expansión de algunas razas de caballos ambladores, uno de ellos y de gran importancia fue; La invasión mora a la Península Ibérica en abril del año 711, los moriscos permanecieron durante ocho siglos en ese territorio y marcaron en forma indeleble las características y costumbres del pueblo español.

Se sabe que Los Moros llevaron con ellos e introdujeron a España caballos de ambos sistemas (Diagonales y laterales), principalmente el caballo de pura raza Árabe de andar diagonal y muy apreciado por su velocidad y hermoso fenotipo, y el Berberisco, de traslación lateral y también muy apreciado, pero por su cómodo andar y gran resistencia para recorrer largas travesías.

Del cruce de las yeguas Andalusís (Traídas por los moros) con los caballos Castellano-Leones (gestado en la península ibérica), se dio origen a unos productos de los que la Lafont-Pauloti dijo que “…parecían haber sido creados por la naturaleza, para el modelo de la fuerza reunida con agilidad”. Más tarde, estos caballos comenzaron a llamarse andaluces y el caballo Castellano-Leones se reservó en este tiempo para las tropas que se enviaban a la conquista de América.

El otro suceso importante fue la introducción del caballo al continente americano, a sabiendas de que en los primeros años se introdujo un caballo para la conquista y colonización, con características particulares, de fortaleza y capacidad de adaptación al medio ambiente, en las Antillas se desarrollaron los primeros criaderos y de allí se abasteció la América continental, ahora bien, el caballo de silla como tal, se cría y evoluciona a partir de la creación de los Virreinatos y Capitanías, ya que estos eran dotados por la corona española de los más distinguidos linajes ecuestres, historiadores y cronistas sostienen que ese caballo de silla, padre de los caballos de paso modernos, se crió con mayor importancia desde su inicio en el sur de América, la razón; es que el Perú alcanzó, a partir del siglo XVII y durante todo el XVIII, un apogeo económico inimaginable.

Una vez fundado el Virreinato del Perú, fundadas también la mayor parte de las ciudades y estando los nativos bajo control casi total, este apogeo hizo que arribara a esta parte del nuevo mundo, lo más granado de la nobleza española y los más afortunados comerciantes que venían en busca de fama, poder y fortuna y, con ellos, aquel caballo generado en el Barroco, imponente, cómodo y garboso, que ya existía en la Península ibérica y que sólo podía ser poseído por quienes detentaban el poder social y económico. Es a partir de allí, que al cruzarse con la yeguada existente desde la conquista, que tenía en su sangre también ascendencia berebere y con tendencia a la ambladura, surge el caballo de paso (Del Perú y a futuro de la Nueva Granada), el cual disociaba su andar lateral en 4 tiempos, lo que lo hacía aun más cómodo, esta inigualable raza fue en su momento símbolo de distinción social.

Cada región o nación, fue cultivando un caballo que se adaptase a las condiciones ambientales, tipos de suelo, climas, alturas y tipo de fauna, por ejemplo el caballo de silla del Perú o caballo Peruano de paso, tiene un tranco muy largo y genera un boleo con sus brazos, que lo hace diferente a sus congéneres y eso se debe a que la raza se cría en una franja costera-arenosa y adquirieron ese “termino” para poder avanzar en la arena, en Colombia el caballo adquiere “resortaje” en el tren posterior y un braceo según la región en la que se críen y crezcan, unos en la zona montañosa de Antioquia y el eje cafetero y otros en los húmedos y pantanosos terrenos de la sabana cundiboyacense, en Venezuela; caballos fuertes, ligeros y resistentes que se gestaban en el clima inclemente de los llanos y que por ello pudieron participar en batallas libertadoras de 5 países, en Brasil, caballos de tranco largo y cómodo para recorrer largas travesías, en las Antillas, caballos capaces de desempeñarse de la misma manera en la arena que en la montaña y así sucesivamente, luego de esa selección genética casi natural, vino la mano del hombre, donde se piensan y gestan los cruces buscando un producto en particular y se le da forma a lo que hoy tenemos.

¿Usted cree que el Paso Fino es una raza pura?

Partiendo del significado de la palabra RAZA, que dice: “son grupos de individuos con las mismas características y rasgos fenotípicos, que se transmiten por herencia genética”. En mi opinión, nuestro caballo de Paso Fino, hoy por hoy, cumple o está muy cerca de cumplir con esa definición conceptual de Raza. Además, con la campaña que a nivel institucional se está trabajando, donde se exige que solo se crucen ejemplares de un mismo andar, cada día se estará más cerca de los parámetros descritos.

En el caso de Puerto Rico y su Raza Caballos de Paso Fino Puro Puertorriqueño, desde hace más de medio siglo que fue reconocida como tal, también, ya Colombia aprobó en el senado de la república, la consideración del Caballo de Paso Fino Colombiano como Patrimonio Nacional.

¿Usted cree que los caballos de Paso Fino registrados en la PFHA son puros?

No necesariamente, ya que, en USA hacen vida ejemplares de la raza Caballos de Paso Fino Puro Puertorriqueño y Caballos de Paso Fino Colombiano, cada raza con características muy diferentes en su condición fenotípica y al cruzarlos pierden todo grado de pureza, para pasar a ser un ejemplar mestizo, no importando su nivel de calidad, conformación y belleza física. Sin embargo, se conocen extraordinarios exponentes mestizos de estas 2 razas, como fue el caso de: Sensitiva de Aracibo (50–50).

¿Es Puro el Caballo de Paso Fino de Puerto Rico?

Como venimos comentando sobre el tema, Puerto Rico y las entidades que rigen el llamado “Purismo” tienen más de medio siglo de haber registrado como raza al Caballo de Paso Fino Puro puertorriqueño, para ese entonces cerraron su libro genealógico y con los ejemplares fundacionales de la raza se han generado los cruces entre sí, para así garantizar la pureza, con contadas excepciones, como fue el permitir utilizar a aquel famoso caballo DULCE SUEÑO, de la raza Morgan, para mejorar algunas falencias y debilidades que surgieron a través de la excesiva consanguinidad.

¿Porque se dice que los Caballos de Paso Fino son los más cómodos para montar en el mundo?

Aparte de ser los mas cómodos, son los mejores para sentirlos y esto se debe a que les acompaña un excelente brío y temperamento. Como decía, el lomo del caballo de Paso Fino, gracias a lo complejo de su locomoción, no ofrece variaciones (Ni verticales, ni horizontales) con relación a la horizontalidad del suelo y mantiene una perfecta estabilidad tanto en los recorridos rectos como en los giros y eso es gracias a su brío, que es el motor que le permite mantenerse en el ritmo y atender inmediatamente a las directrices de quien lo monta, además siempre lo vemos con ese temperamento amable y sumiso, pero con carácter; punto que lo identifica.

Aquellas personas que no han montado un buen caballo del andar del Paso Fino o que se han montado en alguno de baja calidad, emiten conceptos que no describen la verdadera sensación; por su brío y empuje, al tomar las riendas debes concentrarte y emitir órdenes precisas, por otro lado y para sacarle el mayor provecho; debes generar la impulsión correcta y con mucho pulso y oído, ir regulando el avance y la calibración del Paso, hasta llevarlo a su máxima, en la medida que este se oye, emplea mayor energía en su pisada y se siente como si ese binomio dirigiera una orquesta cuya música producida es el tacatacatacataca. También hay que reconocer, que solo el muy bueno te hace vivir una experiencia como la que acabo de narrar, un caballo de mediana calidad, te transporta muy cómodamente y si tiene un tranco largo, te llevara de la manera más agradable a distancias considerables.

¿Que se requiere para tener un caballo de Paso Fino de Silla?

Para mí el caballo de silla primordialmente debe ser cómodo y bueno para sentirlo y para ello requiere de brío y buena rienda, que ofrezca música al oírlo y que en la medida que le exija, me responda con mayor energía en la pisada y mayor brillantez en la ejecución y que si el trayecto es largo, permita andar a un paso más relajado y avanzador, pero sin perder comodidad.

¿Usted que sugiere para hacer una raza de Caballos de Paso Fino?

Volviendo al esquema del significado de RAZA, pienso que lo importante es generar cada día animales más parecidos entre sí, cuyas características fenotípicas permitan identificarlos plenamente, como sucede cuando vez a un Gran Danés o a un Pastor Alemán, o cuando ves a un Frisón o a un Apaloosa, al verlos no tienes dudas de a que raza pertenecen, eso en cuanto a sus colores, tamaño y conformación física, pero en el caballo de Paso Fino, además de sus rasgos físicos, al verlo mover, sus desplazamientos deben ser naturales y por laterales y que no se vea influencia de los aires diagonales.

Para lograrlo se deben seguir cruzando los más finos y naturales entre sí, buscando quizás, compensar lo que le falta a uno con el otro, pero sin recurrir a usar ejemplares de otro andar u otra raza.

Dentro de las líneas del Paso Fino encontramos unas con mayor finura, otras con mayor fluidez, otras con la energía en la pisada, entre ellas puede hacer uno grandes combinaciones buscando el prototipo ideal y sin salirse de los estándares de la raza.

¿Usted que opina de la rapidez en los caballos de Paso Fino actuales y que beneficios le han aportado a la raza del Paso Fino?

Es indiscutible que uno de los cambios más importantes y notorios en la raza del Paso Fino es la “Velocidad del ritmo”, para identificarlo y constatarlo, solo debemos buscar un video de un ejemplar importante de hace 20 años y compararlo con los importantes de hoy en día y la diferencia más significativa va a estar allí, en ese caso, hay quienes pensamos que es una evolución de la raza que se venía gestando mediante los procesos de selección y que ese gen estaba ya presente en la raza, pero no había aflorado a plenitud, mucho tiene que ver la forma en que arreglábamos y enfrenábamos los animales, con exceso de apoyo en la boca y sin flexibilidad en el cuerpo, ni sensibilidad por educación sino que en muchos casos por dolor, así que, la apertura en la utilización de técnicas de manejo y adiestramiento más avanzadas, ha permitido que los ejemplares de Paso Fino desarrollen mayor agilidad y velocidad de movimiento.

Claro está, que a mayor velocidad de ritmo, también se requiere de más trabajo y dedicación para lograr su perfecta calibración, debe estar combinado el talento y el conocimiento a fondo de las diferentes técnicas de manejo, pero es indudable que un ejemplar que ofrezca una rápida velocidad en el ritmo del paso fino, opaca a cualquiera de cadencia media por perfecto que se oiga.

En lo que si no estoy de acuerdo, es en utilizar un ejemplar trochador muy rápido para una yegua menos rápida de Paso Fino y así inducir la velocidad en las crías, habiendo ejemplares del andar del Paso Fino con excelente término de velocidad del ritmo, desde mi forma de ver; sería un retroceso.

¿Usted cree que el mestizaje trae beneficios a la raza del Paso Fino?

Desde mi punto de vista, el mestizaje trae beneficios cuando persigues un fin o resultado que te lo proporcionara el aporte genético del INDIVIDUO PURO, por ejemplo: Si quiero darle tamaño a una cría de una yegua criolla de trabajo, la cruzo con un ejemplar PURO; Ingles o Hannoveriano, de seguro me van a mejorar la condición de tamaño en el producto.

En el caso del Paso Fino, el es un INDIVIDUO PURO y por lo tanto se debe buscar como mejorar cualquier carencia, con los ejemplares de la misma raza, hoy con el banco estadístico que proporcionan las asociaciones registradoras, uno puede determinar cual o cuales sementales dan más alzada, cuales dan mejores aplomos, cuales cierran el color, etc.

¿Como se hizo la raza Trote y Galope Colombiano?

Originalmente, solo competían los caballos de paso y el caballo de trote era considerado de trabajo, de allí la valonada de la crin de uso común en mulas y caballos de trabajo, con el tiempo y a través de los cruces con el Paso Fino, se fueron suavizando y adquiriendo su sitial en la exposiciones equinas de Colombia, posteriormente, ya para mediados y finales de los 60, ocurrió también en las de Venezuela.

A finales de los 50 e inicio de los 60 sonaban los nombres de EL MARQUEZ, FANTASMA, entre otros, luego VALENTINO, CAREY, EL INCA, COSACO, EL DOLLAR, KIOTO, entre muchos otros.

Si analizamos genéticamente a los grandes y más representativos caballos del andar del Trote y Galope de aquella época, encontraremos que muchos, por no decir todos, eran producto del cruce con el Paso Fino, por ejemplo y en los años 70: NAPOLEON (el de Julio Silva) era hijo de DANES (Vinol x La Danesa) en LA DIVINA, hermana completa de DESVELO (Gaucho x Cabinera).

¿Cómo se formo la raza de la Trocha Pura Colombiana y porque tiene ese nombre de Pura Colombiana?

Realmente y por ahora, la trocha está establecida como un andar, mas no como raza, y aunque hoy goza en Colombia con una gran afición que la respalda, tiene una historia muy reciente y con pocos vestigios de pureza. A mediados de los 50, el Paso Fino y la trocha competían juntos en las pistas, quien pone en evidencia las diferencias sonoras de un andar y el otro, es el Juez colombiano Don Tomas Silva Silva, esto ocurrió en una feria en la ciudad de Bogotá, creo, en el 1954 y para lograrlo, ya que no se contaba con el elemento; pista sonora, Don Tomas solicito a la concurrencia salieran al macan (Empedrado) y escucharan las diferencias y premió por primera vez en la historia, a caballos trochadores y de paso por separados. Que nos dice esto? Que visualmente eran iguales.

El andar de la trocha concebido con las características de hoy, se le debe a la yegua DANESA, originalmente llamada ZULIMA y a su prole, que son los que con la influencia del caballo de raza lucitana o portuguez, elevó la alzada, agilizó el tren posterior y nacieron todos los grandes reproductores y yeguas madres de la época, como fueron: DON DANILO FDC con REY COMETA, FANTASÍA con FANTASMA, TORMENTO con CÓNDOR, DALILA FDC con CANARIO, ROSALINDA FDC con RESORTE III, DANÉS con VINOL, DANTE con RESORTE III, RELIQUIA con RESORTE III, TANGO FDC con MARQUÉS Y PACHECO con RESORTE III y de estos salen baluartes como EL ARCO con LA FLECHA (Paso Fino), ELECTRON DE LOS NARANJOS con LA ELECTRA (Trocha), TUPAC AMARU con LA CHULA (Paso Fino), estos 3 últimos, presentes en la genealogía de los grandes ejemplares trochadores modernos.

El término “Pura Colombiana” lo agrega FEDEQUINAS en sus reglamentos a mediados de los 90 y CONFEPASO en sus reglamentos en el año 97.


Entrevista concedida a Mario Escobar Escudero vía internet, en fecha: 22/08/2017.

CARLOS LEMOINE ANDRADE.
Juez Internacional de Equinos.

Posted in Blog

CONTACT US

You have questions, feedback or want to talk to us for more details?

305-972-7650

This email address is being protected from spambots. You need JavaScript enabled to view it.

18690 SW 100th Street
Miami, FL 33196

PROGRAMS

  • Equine Therapy
  • Paso Fino Consulting
  • Instructor Training

REAL ESTATE

Maria A. Escudero

keyeslogo 1